Information In Noncoding For ENCR40130018

Accession Number:  ENCR40130018	Category:   -
Cross-Ref:   -	Description:   tRNA-Met
Organism:   Providencia stuartii strain BE2467	RefSeq:   NZ_CP017054
Condition:   LB medium	locus_tag:   locus_tag:BGK56_RS15425
Date:   2020/6/28	Reference:   Johnson, A. O., et al. (2020). Transposon Insertion Site Sequencing of Providencia stuartii: Essential Genes, Fitness Factors for Catheter-Associated Urinary Tract Infection, and the Impact of Polymicrobial Infection on Fitness Requirements. Msphere, 5(20).

Nucleotide sequence:   CGCGGGATGGAGCAGCTTGGTAGCTCGTCGGGCTCATAACCCGAAGGTCGTCGGTTCAAATCCGGCTCCCGCAACCA

Molecular structure In Noncoding For ENCR40130018

Results for minimum free energy prediction

The optimal secondary structure in dot-bracket notation with a minimum free energy of -29.00 kcal/mol is given below.

.((((((..((((.........)))).(((((.......))))).....(((((.......)))))))))))..... (-29.00) [ VIEW IN FORNA ]

Results for thermodynamic ensemble prediction

The free energy of the thermodynamic ensemble is -29.69 kcal/mol.

The frequency of the MFE structure in the ensemble is 32.82 %.

The ensemble diversity is 4.96

.((((((..((((.,{...,,.)))).(((((.......))))).....(((((.......)))))))))))..... [-29.69]

The centroid secondary structure in dot-bracket notation with a minimum free energy of -29.00 kcal/mol is given below.

.((((((..((((.........)))).(((((.......))))).....(((((.......)))))))))))..... {-29.00 d=2.98} [ VIEW IN FORNA ]