Information In Noncoding For ENCR40130022

Accession Number:  ENCR40130022	Category:   -
Cross-Ref:   -	Description:   tRNA-Gln
Organism:   Providencia stuartii strain BE2467	RefSeq:   NZ_CP017054
Condition:   LB medium	locus_tag:   locus_tag:BGK56_RS18710
Date:   2020/6/28	Reference:   Johnson, A. O., et al. (2020). Transposon Insertion Site Sequencing of Providencia stuartii: Essential Genes, Fitness Factors for Catheter-Associated Urinary Tract Infection, and the Impact of Polymicrobial Infection on Fitness Requirements. Msphere, 5(24).

Nucleotide sequence:   TGGGGTATCGCCAAGCGGTAAGGCACCAGGTTTTGATCCTGGCATTCCCAGGTTCGAATCCTGGTACCCCAGCCA

Molecular structure In Noncoding For ENCR40130022

Results for minimum free energy prediction

The optimal secondary structure in dot-bracket notation with a minimum free energy of -35.30 kcal/mol is given below.

(((((((((((...))))).....((((((.(((((.(((((.....))))).))))).)))))))))))).... (-35.30) [ VIEW IN FORNA ]

Results for thermodynamic ensemble prediction

The free energy of the thermodynamic ensemble is -36.43 kcal/mol.

The frequency of the MFE structure in the ensemble is 15.88 %.

The ensemble diversity is 6.43

((((((({{((,..}})}}...,,((((((.(((((.(((((.....))))).))))).)))))))))))).... [-36.43]

The centroid secondary structure in dot-bracket notation with a minimum free energy of -35.30 kcal/mol is given below.

(((((((((((...))))).....((((((.(((((.(((((.....))))).))))).)))))))))))).... {-35.30 d=4.58} [ VIEW IN FORNA ]