Information In Noncoding For ENCR40130024

Accession Number:  ENCR40130024 Category:   -
Cross-Ref:   - Description:   tRNA-Met
Organism:   Providencia stuartii strain BE2467 RefSeq:   NZ_CP017054
Condition:   LB medium locus_tag:   locus_tag:BGK56_RS18740
Date:   2020/6/28 Reference:   Johnson, A. O., et al. (2020). Transposon Insertion Site Sequencing of Providencia stuartii: Essential Genes, Fitness Factors for Catheter-Associated Urinary Tract Infection, and the Impact of Polymicrobial Infection on Fitness Requirements. Msphere, 5(26).
Nucleotide sequence:   GGCTATGTAGCTCAGCTGGTTAGAGCACAACACTCATAATGTTGGGGTCACAGGTTCGAATCCCGTCATAGCCACCA


Molecular structure In Noncoding For ENCR40130024

Results for minimum free energy prediction

The optimal secondary structure in dot-bracket notation with a minimum free energy of -20.80 kcal/mol is given below.
(((((((..((((.........)))).(((((.......)))))(((((........))..)))..))))))).... (-20.80) [ VIEW IN FORNA ]

Results for thermodynamic ensemble prediction

The free energy of the thermodynamic ensemble is -21.97 kcal/mol.
The frequency of the MFE structure in the ensemble is 14.87 %.
The ensemble diversity is 15.32
(((((((..((((.........)))).{{(({.......})))|(((({........),.,)))..))))))).... [-21.97]


The centroid secondary structure in dot-bracket notation with a minimum free energy of -11.60 kcal/mol is given below.
(((((((..((((.........))))..((((.......)))).....(........)........))))))).... {-11.60 d=10.70} [ VIEW IN FORNA ]