Information In Noncoding For ENCR40140015

Accession Number:  ENCR40140015 Category:   -
Cross-Ref:   GeneID:2986944 Description:   tRNA-Asp
Organism:   Mycoplasma pneumoniae M129 RefSeq:   NC_000912
Condition:   LB agar locus_tag:   locus_tag:MPNt11
Date:   2020/7/10 Reference:   Lluch-Snar, M., et al. (2015). Defining a minimal cell: essentiality of small ORFs and ncRNAs in a genome-reduced bacterium. Molecular systems biology, 11(1), 794.
Nucleotide sequence:   GGTTCCATGGTGTAGTGATAACATATCTCCCTGTCACGGAGGGGTTGCGGGTTTGATTCCCGTTGGAACCGCCA


Molecular structure In Noncoding For ENCR40140015

Results for minimum free energy prediction

The optimal secondary structure in dot-bracket notation with a minimum free energy of -26.50 kcal/mol is given below.
(((((((.(((((.((....)))))))(((((.......)))))..(((((.......)))))))))))).... (-26.50) [ VIEW IN FORNA ]

Results for thermodynamic ensemble prediction

The free energy of the thermodynamic ensemble is -27.20 kcal/mol.
The frequency of the MFE structure in the ensemble is 32.05 %.
The ensemble diversity is 5.69
(((((((.(((((.((....))))))){((((.......))))}..(((((.......)))))))))))).... [-27.20]


The centroid secondary structure in dot-bracket notation with a minimum free energy of -26.50 kcal/mol is given below.
(((((((.(((((.((....)))))))(((((.......)))))..(((((.......)))))))))))).... {-26.50 d=3.36} [ VIEW IN FORNA ]