Information In Noncoding For ENCR40140021

Accession Number:  ENCR40140021	Category:   -
Cross-Ref:   GeneID:2986937	Description:   tRNA-Gln
Organism:   Mycoplasma pneumoniae M129	RefSeq:   NC_000912
Condition:   LB agar	locus_tag:   locus_tag:MPNt21
Date:   2020/7/10	Reference:   Lluch Snar, M., et al. (2015). Defining a minimal cell: essentiality of small ORFs and ncRNAs in a genome-reduced bacterium. Molecular systems biology, 11(1), 800.

Nucleotide sequence:   TGGGATGTAGCCAAGCGGTAAGGCAATAGACTTTGACTCTATCATGCGATGGTTCGATCCCATCCATCCCAGCCA

Molecular structure In Noncoding For ENCR40140021

Results for minimum free energy prediction

The optimal secondary structure in dot-bracket notation with a minimum free energy of -21.50 kcal/mol is given below.

(((((((..(((....)))...((((((((.......)))))..)))(((((.......)))))))))))).... (-21.50) [ VIEW IN FORNA ]

Results for thermodynamic ensemble prediction

The free energy of the thermodynamic ensemble is -22.48 kcal/mol.

The frequency of the MFE structure in the ensemble is 20.37 %.

The ensemble diversity is 23.25

((((((,.{((({.{{|||,.{((((,,,,..}}}.}),))),.})),,|||}}..}}}))),,,,,,,,,.... [-22.48]

The centroid secondary structure in dot-bracket notation with a minimum free energy of -12.70 kcal/mol is given below.

.(((((..(((((.((..(....(((......))).....)....))..)))))..))))).............. {-12.70 d=20.71} [ VIEW IN FORNA ]