Information In Noncoding For ENCR40140022

Accession Number:  ENCR40140022 Category:   -
Cross-Ref:   GeneID:2986936 Description:   tRNA-Tyr
Organism:   Mycoplasma pneumoniae M129 RefSeq:   NC_000912
Condition:   LB agar locus_tag:   locus_tag:MPNt22
Date:   2020/7/10 Reference:   Lluch-Snar, M., et al. (2015). Defining a minimal cell: essentiality of small ORFs and ncRNAs in a genome-reduced bacterium. Molecular systems biology, 11(1), 801.
Nucleotide sequence:   GGACAGGTAGCGAAGTGGCTAAACGCTTCTGACTGTAGATCAGACACCTTCATGGTTTCGGGAGTTCGAATCTCTCCCTGTCCACCA


Molecular structure In Noncoding For ENCR40140022

Results for minimum free energy prediction

The optimal secondary structure in dot-bracket notation with a minimum free energy of -29.10 kcal/mol is given below.
(((((((....((((((......))))))...(((.....)))..(((.....)))...(((((.......)))))))))))).... (-29.10) [ VIEW IN FORNA ]

Results for thermodynamic ensemble prediction

The free energy of the thermodynamic ensemble is -30.39 kcal/mol.
The frequency of the MFE structure in the ensemble is 12.32 %.
The ensemble diversity is 10.86
(((((((....((((((......)))))).|.||{.....}}|{.(((.....))).}}(((((.......)))))))))))).... [-30.39]


The centroid secondary structure in dot-bracket notation with a minimum free energy of -27.00 kcal/mol is given below.
(((((((....((((((......))))))................(((.....)))...(((((.......)))))))))))).... {-27.00 d=6.84} [ VIEW IN FORNA ]