Information In Noncoding For ENCR40140023

Accession Number:  ENCR40140023 Category:   -
Cross-Ref:   GeneID:2986924 Description:   tRNA-Trp
Organism:   Mycoplasma pneumoniae M129 RefSeq:   NC_000912
Condition:   LB agar locus_tag:   locus_tag:MPNt23
Date:   2020/7/10 Reference:   Lluch-Snar, M., et al. (2015). Defining a minimal cell: essentiality of small ORFs and ncRNAs in a genome-reduced bacterium. Molecular systems biology, 11(1), 802.
Nucleotide sequence:   AGGGGTATAGTTCAAAGGTAGAACATCTGTCTTCAAAATAGAGTGTTGTGGGTTCGAGTCCTGCTACCCCTGCCA


Molecular structure In Noncoding For ENCR40140023

Results for minimum free energy prediction

The optimal secondary structure in dot-bracket notation with a minimum free energy of -19.20 kcal/mol is given below.
(((((((((((((.....((.(((((((((.......))))).)))).)).....)))..))).))))))).... (-19.20) [ VIEW IN FORNA ]

Results for thermodynamic ensemble prediction

The free energy of the thermodynamic ensemble is -20.48 kcal/mol.
The frequency of the MFE structure in the ensemble is 12.53 %.
The ensemble diversity is 10.00
(((((((((({((.....((.(((((((((.......))))).)))).)).....)),..))).))))))).... [-20.48]


The centroid secondary structure in dot-bracket notation with a minimum free energy of -18.90 kcal/mol is given below.
((((((((((.((.....((.(((((((((.......))))).)))).)).....))...))).))))))).... {-18.90 d=6.25} [ VIEW IN FORNA ]