Information In Noncoding For ENCR40140025

Accession Number:  ENCR40140025 Category:   -
Cross-Ref:   GeneID:2986939 Description:   tRNA-Leu
Organism:   Mycoplasma pneumoniae M129 RefSeq:   NC_000912
Condition:   LB agar locus_tag:   locus_tag:MPNt27
Date:   2020/7/10 Reference:   Lluch-Snar, M., et al. (2015). Defining a minimal cell: essentiality of small ORFs and ncRNAs in a genome-reduced bacterium. Molecular systems biology, 11(1), 804.
Nucleotide sequence:   GCACTCGTGGCGGAATGGTAGACGCGCTAGACTTAGGATCTAGTTTCATTGTGGAGTGGGGGTTCAAGTCCCTTCGAGTGCACCA


Molecular structure In Noncoding For ENCR40140025

Results for minimum free energy prediction

The optimal secondary structure in dot-bracket notation with a minimum free energy of -26.80 kcal/mol is given below.
((((((((((((............)))))(((((.((((((...(((......)))...)))))))))))....))))))).... (-26.80) [ VIEW IN FORNA ]

Results for thermodynamic ensemble prediction

The free energy of the thermodynamic ensemble is -28.19 kcal/mol.
The frequency of the MFE structure in the ensemble is 10.42 %.
The ensemble diversity is 19.98
(((((((,((((..........,,)})}}(((((.((((((..,{(({,,...}))}},))))))))))),,..))))))).... [-28.19]


The centroid secondary structure in dot-bracket notation with a minimum free energy of -22.30 kcal/mol is given below.
(((((((.((((............)))).(((((.((((((..................)))))))))))....))))))).... {-22.30 d=13.69} [ VIEW IN FORNA ]