Information In Noncoding For ENCR40140026

Accession Number:  ENCR40140026	Category:   -
Cross-Ref:   GeneID:2986926	Description:   tRNA-Lys
Organism:   Mycoplasma pneumoniae M129	RefSeq:   NC_000912
Condition:   LB agar	locus_tag:   locus_tag:MPNt28
Date:   2020/7/10	Reference:   Lluch-Snar, M., et al. (2015). Defining a minimal cell: essentiality of small ORFs and ncRNAs in a genome-reduced bacterium. Molecular systems biology, 11(1), 805.

Nucleotide sequence:   GCATCTTTAGCTCAGTTGGTAGAGCAAATGACTCTTAATCATTGGGTCGGGGGTTCGAGCCCCTCAAGATGCACCA

Molecular structure In Noncoding For ENCR40140026

Results for minimum free energy prediction

The optimal secondary structure in dot-bracket notation with a minimum free energy of -28.10 kcal/mol is given below.

(((((((..((((........))))....(((((.........)))))((((((....)))))).))))))).... (-28.10) [ VIEW IN FORNA ]

Results for thermodynamic ensemble prediction

The free energy of the thermodynamic ensemble is -28.72 kcal/mol.

The frequency of the MFE structure in the ensemble is 36.82 %.

The ensemble diversity is 5.83

(((((((..((((........))))....(((((.........)))))((((((....)))))).))))))).... [-28.72]

The centroid secondary structure in dot-bracket notation with a minimum free energy of -28.10 kcal/mol is given below.

(((((((..((((........))))....(((((.........)))))((((((....)))))).))))))).... {-28.10 d=3.29} [ VIEW IN FORNA ]