Information In Noncoding For ENCR40140027

Accession Number:  ENCR40140027	Category:   -
Cross-Ref:   GeneID:2986925	Description:   tRNA-Thr
Organism:   Mycoplasma pneumoniae M129	RefSeq:   NC_000912
Condition:   LB agar	locus_tag:   locus_tag:MPNt29
Date:   2020/7/10	Reference:   Lluch-Snar, M., et al. (2015). Defining a minimal cell: essentiality of small ORFs and ncRNAs in a genome-reduced bacterium. Molecular systems biology, 11(1), 806.

Nucleotide sequence:   GCCGACTTAGCTCAGTTGGTAGAGCAATTGACTTGTAATCAGTAGGTCGTAGGTTCGAATCCTATAGTCGGCACCA

Molecular structure In Noncoding For ENCR40140027

Results for minimum free energy prediction

The optimal secondary structure in dot-bracket notation with a minimum free energy of -25.10 kcal/mol is given below.

(((((((..((((........))))....((((((.......))))))(((((.......)))))))))))).... (-25.10) [ VIEW IN FORNA ]

Results for thermodynamic ensemble prediction

The free energy of the thermodynamic ensemble is -25.90 kcal/mol.

The frequency of the MFE structure in the ensemble is 27.49 %.

The ensemble diversity is 14.81

(((((((..((((........))))...,((((((......,}}))))(((((.......)))))))))))).... [-25.90]

The centroid secondary structure in dot-bracket notation with a minimum free energy of -25.10 kcal/mol is given below.

(((((((..((((........))))....((((((.......))))))(((((.......)))))))))))).... {-25.10 d=10.20} [ VIEW IN FORNA ]