Information In Noncoding For ENCR40140028

Accession Number:  ENCR40140028 Category:   -
Cross-Ref:   GeneID:2986919 Description:   tRNA-Val
Organism:   Mycoplasma pneumoniae M129 RefSeq:   NC_000912
Condition:   LB agar locus_tag:   locus_tag:MPNt30
Date:   2020/7/10 Reference:   Lluch-Snar, M., et al. (2015). Defining a minimal cell: essentiality of small ORFs and ncRNAs in a genome-reduced bacterium. Molecular systems biology, 11(1), 807.
Nucleotide sequence:   GGATTGTTAGCTCAGCTGGGAGAGCATATGCCTTACAAGCATAGGGTCGGGGGTTCGATCCCCTCACAATCCACCA


Molecular structure In Noncoding For ENCR40140028

Results for minimum free energy prediction

The optimal secondary structure in dot-bracket notation with a minimum free energy of -26.30 kcal/mol is given below.
(((((((..((((........))))....((((((......)))))).((((((...))))))..))))))).... (-26.30) [ VIEW IN FORNA ]

Results for thermodynamic ensemble prediction

The free energy of the thermodynamic ensemble is -27.51 kcal/mol.
The frequency of the MFE structure in the ensemble is 14.02 %.
The ensemble diversity is 15.92
(((((((..((((........))))....((((({......)))))).(((((,...,,)))),.))))))).... [-27.51]


The centroid secondary structure in dot-bracket notation with a minimum free energy of -17.10 kcal/mol is given below.
(((((((..((((........))))....((((((......))))))..................))))))).... {-17.10 d=11.28} [ VIEW IN FORNA ]