Information In Noncoding For ENCR40140030

Accession Number:  ENCR40140030 Category:   -
Cross-Ref:   GeneID:2986927 Description:   tRNA-Glu
Organism:   Mycoplasma pneumoniae M129 RefSeq:   NC_000912
Condition:   LB agar locus_tag:   locus_tag:MPNt32
Date:   2020/7/10 Reference:   Lluch-Snar, M., et al. (2015). Defining a minimal cell: essentiality of small ORFs and ncRNAs in a genome-reduced bacterium. Molecular systems biology, 11(1), 809.
Nucleotide sequence:   GGCGCGTTGGTGAAGAGACTTAACACACACGCCTTTCACGCGTGCATTCACGGGTTTGAATCCCGTACGCGTCACCA


Molecular structure In Noncoding For ENCR40140030

Results for minimum free energy prediction

The optimal secondary structure in dot-bracket notation with a minimum free energy of -24.70 kcal/mol is given below.
((((((((((.((..((((((......(((((.......))))).......))))))...))))).))))))).... (-24.70) [ VIEW IN FORNA ]

Results for thermodynamic ensemble prediction

The free energy of the thermodynamic ensemble is -26.01 kcal/mol.
The frequency of the MFE structure in the ensemble is 12.02 %.
The ensemble diversity is 23.03
(((((((,{({,{,,..,|||..}.,.(((((.......))))).....{{{||,.,....))))}))))))).... [-26.01]


The centroid secondary structure in dot-bracket notation with a minimum free energy of -21.50 kcal/mol is given below.
(((((((....................(((((.......)))))......((((.......)))).))))))).... {-21.50 d=16.15} [ VIEW IN FORNA ]