Information In Noncoding For ENCR40140031

Accession Number:  ENCR40140031 Category:   -
Cross-Ref:   GeneID:2986930 Description:   tRNA-Asn
Organism:   Mycoplasma pneumoniae M129 RefSeq:   NC_000912
Condition:   LB agar locus_tag:   locus_tag:MPNt33
Date:   2020/7/10 Reference:   Lluch-Snar, M., et al. (2015). Defining a minimal cell: essentiality of small ORFs and ncRNAs in a genome-reduced bacterium. Molecular systems biology, 11(1), 810.
Nucleotide sequence:   GGCCACATAGCTCAGCGGTAGAGCAACCGGCTGTTAACCGGTTGGTCACAGGTTCGATCCCTGTTGTGGCCGCCA


Molecular structure In Noncoding For ENCR40140031

Results for minimum free energy prediction

The optimal secondary structure in dot-bracket notation with a minimum free energy of -32.10 kcal/mol is given below.
((((((((((.(((((.((.((.(((((((.......))))))).))))..))).))...))).))))))).... (-32.10) [ VIEW IN FORNA ]

Results for thermodynamic ensemble prediction

The free energy of the thermodynamic ensemble is -33.17 kcal/mol.
The frequency of the MFE structure in the ensemble is 17.51 %.
The ensemble diversity is 12.94
((((((({{(,({{{{.{{.((.(((((((.......))))))).))||,,|}}.}}..,)))}})))))).... [-33.17]


The centroid secondary structure in dot-bracket notation with a minimum free energy of -31.40 kcal/mol is given below.
((((((((((.(((((....((.(((((((.......))))))).))....))).))...))).))))))).... {-31.40 d=9.89} [ VIEW IN FORNA ]