Information In Noncoding For ENCR40140032

Accession Number:  ENCR40140032 Category:   -
Cross-Ref:   GeneID:2986947 Description:   tRNA-His
Organism:   Mycoplasma pneumoniae M129 RefSeq:   NC_000912
Condition:   LB agar locus_tag:   locus_tag:MPNt34
Date:   2020/7/10 Reference:   Lluch-Snar, M., et al. (2015). Defining a minimal cell: essentiality of small ORFs and ncRNAs in a genome-reduced bacterium. Molecular systems biology, 11(1), 811.
Nucleotide sequence:   GCGATTGTGGCGAAGTGGTTAACGCACCTGATTGTGGATCAGGCATTCGTGGGTTCAATTCCCATCAGTCGCCCCA


Molecular structure In Noncoding For ENCR40140032

Results for minimum free energy prediction

The optimal secondary structure in dot-bracket notation with a minimum free energy of -26.70 kcal/mol is given below.
((((((((((.(((.(((...(((..(((((((...)))))))....)))....))).)))))).))))))).... (-26.70) [ VIEW IN FORNA ]

Results for thermodynamic ensemble prediction

The free energy of the thermodynamic ensemble is -27.38 kcal/mol.
The frequency of the MFE structure in the ensemble is 33.24 %.
The ensemble diversity is 5.89
((((((((((.(((.(((...(((..(((((((...)))))))....)))....))).)))))).))))))).... [-27.38]


The centroid secondary structure in dot-bracket notation with a minimum free energy of -26.70 kcal/mol is given below.
((((((((((.(((.(((...(((..(((((((...)))))))....)))....))).)))))).))))))).... {-26.70 d=3.52} [ VIEW IN FORNA ]