Information In Noncoding For ENCR40140033

Accession Number:  ENCR40140033 Category:   -
Cross-Ref:   GeneID:2986932 Description:   tRNA-Leu
Organism:   Mycoplasma pneumoniae M129 RefSeq:   NC_000912
Condition:   LB agar locus_tag:   locus_tag:MPNt35
Date:   2020/7/10 Reference:   Lluch-Snar, M., et al. (2015). Defining a minimal cell: essentiality of small ORFs and ncRNAs in a genome-reduced bacterium. Molecular systems biology, 11(1), 812.
Nucleotide sequence:   GTCGGAGTGGTGGAATGGTAGACACGCAAGCTTGAGGGGCTTGTGGTCGCAAGACTGTGCCAGTTCAAGTCTGGTCTCCGACACCA


Molecular structure In Noncoding For ENCR40140033

Results for minimum free energy prediction

The optimal secondary structure in dot-bracket notation with a minimum free energy of -31.70 kcal/mol is given below.
(((((((.((((((.((((((((.(((((((((...)))))))))))).........))))).))))...))...))))))).... (-31.70) [ VIEW IN FORNA ]

Results for thermodynamic ensemble prediction

The free energy of the thermodynamic ensemble is -33.80 kcal/mol.
The frequency of the MFE structure in the ensemble is 3.32 %.
The ensemble diversity is 16.53
(((((((.,{{{{{.{{((,(((.(((((((({...}))))))))))).,...,,,,}||||,}}},...)),,.))))))).... [-33.80]


The centroid secondary structure in dot-bracket notation with a minimum free energy of -25.90 kcal/mol is given below.
(((((((........((((.(((.(((((((((...))))))))))))..........)))).............))))))).... {-25.90 d=11.44} [ VIEW IN FORNA ]