Information In Noncoding For ENCR40140034

Accession Number:  ENCR40140034	Category:   -
Cross-Ref:   GeneID:2986923	Description:   tRNA-Arg
Organism:   Mycoplasma pneumoniae M129	RefSeq:   NC_000912
Condition:   LB agar	locus_tag:   locus_tag:MPNt37
Date:   2020/7/10	Reference:   Lluch-Snar, M., et al. (2015). Defining a minimal cell: essentiality of small ORFs and ncRNAs in a genome-reduced bacterium. Molecular systems biology, 11(1), 813.

Nucleotide sequence:   GCGTCGGTAGCTCAGCGGATAGAGTACACGCCTTCTAAGTGTGTTGTCGTGGGTTCGAGTCCCACCCGATGCGCCA

Molecular structure In Noncoding For ENCR40140034

Results for minimum free energy prediction

The optimal secondary structure in dot-bracket notation with a minimum free energy of -27.80 kcal/mol is given below.

(((((((..((((........))))((((((.......))))))....(((((.......)))))))))))).... (-27.80) [ VIEW IN FORNA ]

Results for thermodynamic ensemble prediction

The free energy of the thermodynamic ensemble is -28.14 kcal/mol.

The frequency of the MFE structure in the ensemble is 57.27 %.

The ensemble diversity is 4.89

(((((((..((((........))))((((((.......))))))....(((((.......)))))))))))).... [-28.14]

The centroid secondary structure in dot-bracket notation with a minimum free energy of -27.80 kcal/mol is given below.

(((((((..((((........))))((((((.......))))))....(((((.......)))))))))))).... {-27.80 d=2.69} [ VIEW IN FORNA ]