Accession Number |
|
Cross-Ref |
Description |
|
RefSeq |
|
locus_tag |
Nucleotide_sequence |
ENCR40010151 |
promoter; regulatory region |
Regulatory_region_ID: RR_99993 |
TSS position: -; CCNA leading gene: CCNA_99993 ; CCNA lagging gene: CCNA_99993 ; annotation of leading gene: tRNA-Thr |
Caulobacter crescentus |
NC_011916 |
Rich medium |
- |
UGCAAGACGGCGCUUGCCGAGCGGCUCGCGCGCCGCUAAAUAGGCGCUCCCUUCGCUCUGGAGCGCCCGCUUCGGAGCCCGUGGG |
ENCR40010152 |
promoter; regulatory region |
Regulatory_region_ID: RR_00082 |
TSS position: 19a ; CCNA leading gene: CCNA_00082 ; CCNA lagging gene: CCNA_00082 ; annotation of leading gene: class 1 lysyl-tRNA synthetase |
Caulobacter crescentus |
NC_011916 |
Rich medium |
- |
CCCUAGCCCUCCGCCCUCGCGCGGUUUAUACGCCCCGC |
ENCR40010153 |
promoter; regulatory region |
Regulatory_region_ID: RR_00100 |
TSS position: -; CCNA leading gene: CCNA_00100 ; CCNA lagging gene: CCNA_00100 ; annotation of leading gene: ribulose-phosphate 3-epimerase |
Caulobacter crescentus |
NC_011916 |
Rich medium |
- |
CGCUAUCCCAGGGCC |
ENCR40010154 |
promoter; regulatory region |
Regulatory_region_ID: RR_00106 |
TSS position: -; CCNA leading gene: CCNA_00106 ; CCNA lagging gene: CCNA_00106 ; annotation of leading gene: 2-polyprenyl-6-methoxyphenol hydroxylase |
Caulobacter crescentus |
NC_011916 |
Rich medium |
- |
CUCUGGACAGCGACCGGCGGCGAGGCCCAUAUCGCCGCCA |
ENCR40010155 |
promoter; regulatory region |
Regulatory_region_ID: RR_00107 |
TSS position: -; CCNA leading gene: CCNA_00107 ; CCNA lagging gene: CCNA_00107 ; annotation of leading gene: hypothetical protein |
Caulobacter crescentus |
NC_011916 |
Rich medium |
- |
ATCCAGTAGACAGAGTCC |
ENCR40010156 |
promoter; regulatory region |
Regulatory_region_ID: RR_00116 |
TSS position: 129a |
Caulobacter crescentus |
NC_011916 |
Rich medium |
|
CCCUAAAGAGACGACAGCACGACC |
ENCR40010157 |
promoter; regulatory region |
Regulatory_region_ID: RR_00117 |
"TSS position: 71b ; CCNA leading gene: CCNA_00117 ; CCNA lagging gene: CCNA_00117 ; annotation of leading gene: glucosamine-fructose-6-phosphate aminotransferase, isomerizing" |
Caulobacter crescentus |
NC_011916 |
Rich medium |
|
GCCAGUGCUAAAGGCGCCUCACGGAAAUUCGCGUGUCGGUAGGCAUAAUCCUGUCGGCGCGUUCUACAAGGGAUCAUGGCCCA |
ENCR40010158 |
promoter; regulatory region |
Regulatory_region_ID: RR_00153 |
TSS position: 128b ; CCNA leading gene: CCNA_00153 ; CCNA lagging gene: CCNA_00153 ; annotation of leading gene: GrpE protein |
Caulobacter crescentus |
NC_011916 |
Rich medium |
- |
AUAAGGACUUUACCCAA |
ENCR40010159 |
promoter; regulatory region |
Regulatory_region_ID: RR_00155 |
TSS position: 69a ; CCNA leading gene: CCNA_00155 ; CCNA lagging gene: CCNA_00155 ; annotation of leading gene: DNA polymerase III |
Caulobacter crescentus |
NC_011916 |
Rich medium |
|
GUUUCGGCCUCUUCCCCGCGCGCGUCUUUUCGCUAAUGUCGGCGGUCCCUUCUCCACGGGUUCGCGCGGGGCUGAUUCUCCCCGGCGGCGGCUGAACCCGACAUCUGGACCGGACUA |
ENCR40010160 |
promoter; regulatory region |
Regulatory_region_ID: RR_00159 |
TSS position: 178b ; CCNA leading gene: CCNA_00159 ; CCNA lagging gene: CCNA_00159 ; annotation of leading gene: DNA gyrase subunit B |
Caulobacter crescentus |
NC_011916 |
Rich medium |
- |
UGUAAUAUUGCUCGACGAAGUCGCCGCGCAUCUCGACCUUACCCGGCGAGCCGCUCUGGCUGACGAACUCACGGCGCUCAAGCUCCAGGCCUUCCUGACCGGCACGGACGAGUCGCUGUUCGACCAUCUCAAGGGUCGGGCGCUAGGCGUUCGCGUGGGCGACGCCGGCCUGACUACUCUGGAAGACGAAUGACCGAGAACACCGAAGACCAAGUUCCCGACCUGUCGACCCCGGAAA |
ENCR40010161 |
promoter; regulatory region |
Regulatory_region_ID: RR_99992 |
TSS position: -; CCNA leading gene: CCNA_99992 ; CCNA lagging gene: CCNA_99992 ; annotation of leading gene: tRNA-Arg |
Caulobacter crescentus |
NC_011916 |
Rich medium |
- |
CGUUUGCGCCGGCCUCGCCUUUCGGCUAAGACCCGCUUCCCGCCUCCUGGGUUUCCAGGAAGGUCGCAG |
ENCR40010162 |
promoter; regulatory region |
Regulatory_region_ID: RR_00197 |
TSS position: -; CCNA leading gene: CCNA_00197 ; CCNA lagging gene: CCNA_00197 ; annotation of leading gene: LSU ribosomal protein L19P |
Caulobacter crescentus |
NC_011916 |
Rich medium |
- |
ACCCGAAACCGGGUAAGCCCAAGGAGAC |
ENCR40010163 |
promoter; regulatory region |
Regulatory_region_ID: RR_00211 |
TSS position: -; CCNA leading gene: CCNA_00211 ; CCNA lagging gene: CCNA_00212 ; annotation of leading gene: agmatine deiminase |
Caulobacter crescentus |
NC_011916 |
Rich medium |
- |
GCUUGACCCCGGCGUCGUGAGGGGCCAUCUGCGCCCCCUUCGUUUUUCCCUGACCGCUUUUCACUGGGCUUGUCGAA |
ENCR40010164 |
promoter; regulatory region |
Regulatory_region_ID: RR_00222 |
TSS position: -; CCNA leading gene: CCNA_00222 ; CCNA lagging gene: CCNA_00222 ; annotation of leading gene: glucose-6-phosphate isomerase/glucose-6 phosphate 1-epimerase |
Caulobacter crescentus |
NC_011916 |
Rich medium |
- |
GUCCGUAAACAGCGAUUUACCAAACCUGUGAGGACGACA |
ENCR40010165 |
promoter; regulatory region |
Regulatory_region_ID: RR_00231 |
TSS position: -; CCNA leading gene: CCNA_00231 ; CCNA lagging gene: CCNA_00231 ; annotation of leading gene: tRNA-specific adenosine deaminase |
Caulobacter crescentus |
NC_011916 |
Rich medium |
- |
AUCAAGACCACCGCAUGA |
ENCR40010166 |
promoter; regulatory region |
Regulatory_region_ID: RR_00261 |
TSS position: 40a |
Caulobacter crescentus |
NC_011916 |
Rich medium |
|
UAAAGCACCUUACCGCGUCCGCUCGAUUCUGCCCGAGGCCCUGUCA |
ENCR40010167 |
promoter; regulatory region |
Regulatory_region_ID: RR_99940 |
TSS position: -; CCNA leading gene: CCNA_99940 ; CCNA lagging gene: CCNA_99940 ; annotation of leading gene: 4.5S RNA |
Caulobacter crescentus |
NC_011916 |
Rich medium |
- |
CCUUGCAUCCUGCGCGAUGAGUCGCGAUAUAGGCCUCGGAGAUCGGCGCGGACGGAGUCCUCGCCAACCUGGUCAGG |
ENCR40010168 |
promoter; regulatory region |
Regulatory_region_ID: RR_00268 |
TSS position: 0b ; CCNA leading gene: CCNA_00268 ; CCNA lagging gene: CCNA_00268 ; annotation of leading gene: DNA polymerase III subunit gamma/tau |
Caulobacter crescentus |
NC_011916 |
Rich medium |
- |
CCCACUACACUCCGCGCCA |
ENCR40010169 |
promoter; regulatory region |
Regulatory_region_ID: RR_00273 |
TSS position: -; CCNA leading gene: CCNA_00273 ; CCNA lagging gene: CCNA_00273 ; annotation of leading gene: peptide deformylase |
Caulobacter crescentus |
NC_011916 |
Rich medium |
- |
CCUGACGCUCAUCA |
ENCR40010170 |
promoter; regulatory region |
Regulatory_region_ID: RR_00277 |
TSS position: -; CCNA leading gene: CCNA_00277 ; CCNA lagging gene: CCNA_00277 ; annotation of leading gene: succinyl-diaminopimelate desuccinylase |
Caulobacter crescentus |
NC_011916 |
Rich medium |
- |
CCUGCACCA |
ENCR40010171 |
promoter; regulatory region |
Regulatory_region_ID: RR_00283 |
TSS position: -; CCNA leading gene: CCNA_00283 ; CCNA lagging gene: CCNA_00283 ; annotation of leading gene: 2 |
Caulobacter crescentus |
NC_011916 |
Rich medium |
|
GCCUCGACCUCCGAACACGUCCAUUUCCGCACCAACGAUCUCGCCGAGUUCCUGAGCUCGGCGCGCCUGCAAGGAAGCCCCGC |
ENCR40010172 |
promoter; regulatory region |
Regulatory_region_ID: RR_00295 |
TSS position: -; CCNA leading gene: CCNA_00295 ; CCNA lagging gene: CCNA_00295 ; annotation of leading gene: phosphate transport system protein phoU |
Caulobacter crescentus |
NC_011916 |
Rich medium |
- |
GAGAAAACAGAGA |
ENCR40010173 |
promoter; regulatory region |
Regulatory_region_ID: RR_00304 |
TSS position: -; CCNA leading gene: CCNA_00304 ; CCNA lagging gene: CCNA_00303 ; annotation of leading gene: 3-deoxy-D-manno-octulosonic-acid transferase |
Caulobacter crescentus |
NC_011916 |
Rich medium |
- |
GACCUGCACAUCUGGGCGAUGAGCACCACCGAGACCGCCCUGACCGCCCACGUCGUCCGUCAGCUGGACGCCGACCAUGACCAGUUCCUGCACGACGCCUGCGCCGAACUGGCCAGCCGGUUCAACAUCGGCCACGUGACCAUCCAGGUGGAAAGCGGCCACGGCGCGCAUGC |
ENCR40010174 |
promoter; regulatory region |
Regulatory_region_ID: RR_00306 |
TSS position: -; CCNA leading gene: CCNA_00306 ; CCNA lagging gene: CCNA_00306 ; annotation of leading gene: hypothetical protein |
Caulobacter crescentus |
NC_011916 |
Rich medium |
- |
GAUCUGGACCACCCGGCGCCCGACCAGGACGGGGAGAUCACGGC |
ENCR40010175 |
promoter; regulatory region |
Regulatory_region_ID: RR_00307 |
TSS position: -; CCNA leading gene: CCNA_00307 ; CCNA lagging gene: CCNA_00307 ; annotation of leading gene: phospholipid-lipopolysaccharide ABC transporter |
Caulobacter crescentus |
NC_011916 |
Rich medium |
- |
GCCUCGCCCUGACAGCCGACCCCUCCCCC |
ENCR40010176 |
promoter; regulatory region |
Regulatory_region_ID: RR_00308 |
TSS position: -; CCNA leading gene: CCNA_00308 ; CCNA lagging gene: CCNA_00308 ; annotation of leading gene: hypothetical protein |
Caulobacter crescentus |
NC_011916 |
Rich medium |
- |
CCCUAGUUAGGACCGGAAUUUCCGAAGGAUCGCGCCGCCU |
ENCR40010177 |
promoter; regulatory region |
Regulatory_region_ID: RR_00309 |
TSS position: -; CCNA leading gene: CCNA_00309 ; CCNA lagging gene: CCNA_00309 ; annotation of leading gene: cytosolic protein |
Caulobacter crescentus |
NC_011916 |
Rich medium |
- |
CCAUUGAUCCUUAACCGUGUCGGGCAUAUCGAGCUGCCAUAACUAUAAUUCCUCGCAGGAAC |
ENCR40010178 |
promoter; regulatory region |
Regulatory_region_ID: RR_00317 |
TSS position: -66a ; CCNA leading gene: CCNA_00317 ; CCNA lagging gene: CCNA_00317 ; annotation of leading gene: GTP-binding protein CgtA |
Caulobacter crescentus |
NC_011916 |
Rich medium |
- |
CCUUGGGACAAAAGGACCCC |
ENCR40010179 |
promoter; regulatory region |
Regulatory_region_ID: RR_00320 |
TSS position: -; CCNA leading gene: CCNA_00320 ; CCNA lagging gene: CCNA_00320 ; annotation of leading gene: LSU ribosomal protein L27P |
Caulobacter crescentus |
NC_011916 |
Rich medium |
- |
CUUCUAAGGUAGGAGAGCAAG |
ENCR40010180 |
promoter; regulatory region |
Regulatory_region_ID: RR_00321 |
TSS position: 72a ; CCNA leading gene: CCNA_00321 ; CCNA lagging gene: CCNA_00321 ; annotation of leading gene: LSU ribosomal protein L21P |
Caulobacter crescentus |
NC_011916 |
Rich medium |
- |
GCCCUCUUGUGUGCUUUCGUCGCGCGCCUCGGCUGAAUCCGCCGCUACGCCGUUGACUCCCGAGCCUUGGGCUGUAUAAGUCGCGCCCUCUUCGCCCGCCGGGUUUCCGAGCGGGCGUUCCCUAUUUUGCGAACGCACGUUUUUAAGGCGCUAACCU |