Accession Number
Cross-Ref Description
RefSeq
locus_tag Nucleotide_sequence
ENCR40010151 promoter; regulatory region Regulatory_region_ID: RR_99993 TSS position: -; CCNA leading gene: CCNA_99993 ; CCNA lagging gene: CCNA_99993 ; annotation of leading gene: tRNA-Thr Caulobacter crescentus NC_011916 Rich medium - UGCAAGACGGCGCUUGCCGAGCGGCUCGCGCGCCGCUAAAUAGGCGCUCCCUUCGCUCUGGAGCGCCCGCUUCGGAGCCCGUGGG
ENCR40010152 promoter; regulatory region Regulatory_region_ID: RR_00082 TSS position: 19a ; CCNA leading gene: CCNA_00082 ; CCNA lagging gene: CCNA_00082 ; annotation of leading gene: class 1 lysyl-tRNA synthetase Caulobacter crescentus NC_011916 Rich medium - CCCUAGCCCUCCGCCCUCGCGCGGUUUAUACGCCCCGC
ENCR40010153 promoter; regulatory region Regulatory_region_ID: RR_00100 TSS position: -; CCNA leading gene: CCNA_00100 ; CCNA lagging gene: CCNA_00100 ; annotation of leading gene: ribulose-phosphate 3-epimerase Caulobacter crescentus NC_011916 Rich medium - CGCUAUCCCAGGGCC
ENCR40010154 promoter; regulatory region Regulatory_region_ID: RR_00106 TSS position: -; CCNA leading gene: CCNA_00106 ; CCNA lagging gene: CCNA_00106 ; annotation of leading gene: 2-polyprenyl-6-methoxyphenol hydroxylase Caulobacter crescentus NC_011916 Rich medium - CUCUGGACAGCGACCGGCGGCGAGGCCCAUAUCGCCGCCA
ENCR40010155 promoter; regulatory region Regulatory_region_ID: RR_00107 TSS position: -; CCNA leading gene: CCNA_00107 ; CCNA lagging gene: CCNA_00107 ; annotation of leading gene: hypothetical protein Caulobacter crescentus NC_011916 Rich medium - ATCCAGTAGACAGAGTCC
ENCR40010156 promoter; regulatory region Regulatory_region_ID: RR_00116 TSS position: 129a Caulobacter crescentus NC_011916 Rich medium CCCUAAAGAGACGACAGCACGACC
ENCR40010157 promoter; regulatory region Regulatory_region_ID: RR_00117 "TSS position: 71b ; CCNA leading gene: CCNA_00117 ; CCNA lagging gene: CCNA_00117 ; annotation of leading gene: glucosamine-fructose-6-phosphate aminotransferase, isomerizing" Caulobacter crescentus NC_011916 Rich medium GCCAGUGCUAAAGGCGCCUCACGGAAAUUCGCGUGUCGGUAGGCAUAAUCCUGUCGGCGCGUUCUACAAGGGAUCAUGGCCCA
ENCR40010158 promoter; regulatory region Regulatory_region_ID: RR_00153 TSS position: 128b ; CCNA leading gene: CCNA_00153 ; CCNA lagging gene: CCNA_00153 ; annotation of leading gene: GrpE protein Caulobacter crescentus NC_011916 Rich medium - AUAAGGACUUUACCCAA
ENCR40010159 promoter; regulatory region Regulatory_region_ID: RR_00155 TSS position: 69a ; CCNA leading gene: CCNA_00155 ; CCNA lagging gene: CCNA_00155 ; annotation of leading gene: DNA polymerase III Caulobacter crescentus NC_011916 Rich medium GUUUCGGCCUCUUCCCCGCGCGCGUCUUUUCGCUAAUGUCGGCGGUCCCUUCUCCACGGGUUCGCGCGGGGCUGAUUCUCCCCGGCGGCGGCUGAACCCGACAUCUGGACCGGACUA
ENCR40010160 promoter; regulatory region Regulatory_region_ID: RR_00159 TSS position: 178b ; CCNA leading gene: CCNA_00159 ; CCNA lagging gene: CCNA_00159 ; annotation of leading gene: DNA gyrase subunit B Caulobacter crescentus NC_011916 Rich medium - UGUAAUAUUGCUCGACGAAGUCGCCGCGCAUCUCGACCUUACCCGGCGAGCCGCUCUGGCUGACGAACUCACGGCGCUCAAGCUCCAGGCCUUCCUGACCGGCACGGACGAGUCGCUGUUCGACCAUCUCAAGGGUCGGGCGCUAGGCGUUCGCGUGGGCGACGCCGGCCUGACUACUCUGGAAGACGAAUGACCGAGAACACCGAAGACCAAGUUCCCGACCUGUCGACCCCGGAAA
ENCR40010161 promoter; regulatory region Regulatory_region_ID: RR_99992 TSS position: -; CCNA leading gene: CCNA_99992 ; CCNA lagging gene: CCNA_99992 ; annotation of leading gene: tRNA-Arg Caulobacter crescentus NC_011916 Rich medium - CGUUUGCGCCGGCCUCGCCUUUCGGCUAAGACCCGCUUCCCGCCUCCUGGGUUUCCAGGAAGGUCGCAG
ENCR40010162 promoter; regulatory region Regulatory_region_ID: RR_00197 TSS position: -; CCNA leading gene: CCNA_00197 ; CCNA lagging gene: CCNA_00197 ; annotation of leading gene: LSU ribosomal protein L19P Caulobacter crescentus NC_011916 Rich medium - ACCCGAAACCGGGUAAGCCCAAGGAGAC
ENCR40010163 promoter; regulatory region Regulatory_region_ID: RR_00211 TSS position: -; CCNA leading gene: CCNA_00211 ; CCNA lagging gene: CCNA_00212 ; annotation of leading gene: agmatine deiminase Caulobacter crescentus NC_011916 Rich medium - GCUUGACCCCGGCGUCGUGAGGGGCCAUCUGCGCCCCCUUCGUUUUUCCCUGACCGCUUUUCACUGGGCUUGUCGAA
ENCR40010164 promoter; regulatory region Regulatory_region_ID: RR_00222 TSS position: -; CCNA leading gene: CCNA_00222 ; CCNA lagging gene: CCNA_00222 ; annotation of leading gene: glucose-6-phosphate isomerase/glucose-6 phosphate 1-epimerase Caulobacter crescentus NC_011916 Rich medium - GUCCGUAAACAGCGAUUUACCAAACCUGUGAGGACGACA
ENCR40010165 promoter; regulatory region Regulatory_region_ID: RR_00231 TSS position: -; CCNA leading gene: CCNA_00231 ; CCNA lagging gene: CCNA_00231 ; annotation of leading gene: tRNA-specific adenosine deaminase Caulobacter crescentus NC_011916 Rich medium - AUCAAGACCACCGCAUGA
ENCR40010166 promoter; regulatory region Regulatory_region_ID: RR_00261 TSS position: 40a Caulobacter crescentus NC_011916 Rich medium UAAAGCACCUUACCGCGUCCGCUCGAUUCUGCCCGAGGCCCUGUCA
ENCR40010167 promoter; regulatory region Regulatory_region_ID: RR_99940 TSS position: -; CCNA leading gene: CCNA_99940 ; CCNA lagging gene: CCNA_99940 ; annotation of leading gene: 4.5S RNA Caulobacter crescentus NC_011916 Rich medium - CCUUGCAUCCUGCGCGAUGAGUCGCGAUAUAGGCCUCGGAGAUCGGCGCGGACGGAGUCCUCGCCAACCUGGUCAGG
ENCR40010168 promoter; regulatory region Regulatory_region_ID: RR_00268 TSS position: 0b ; CCNA leading gene: CCNA_00268 ; CCNA lagging gene: CCNA_00268 ; annotation of leading gene: DNA polymerase III subunit gamma/tau Caulobacter crescentus NC_011916 Rich medium - CCCACUACACUCCGCGCCA
ENCR40010169 promoter; regulatory region Regulatory_region_ID: RR_00273 TSS position: -; CCNA leading gene: CCNA_00273 ; CCNA lagging gene: CCNA_00273 ; annotation of leading gene: peptide deformylase Caulobacter crescentus NC_011916 Rich medium - CCUGACGCUCAUCA
ENCR40010170 promoter; regulatory region Regulatory_region_ID: RR_00277 TSS position: -; CCNA leading gene: CCNA_00277 ; CCNA lagging gene: CCNA_00277 ; annotation of leading gene: succinyl-diaminopimelate desuccinylase Caulobacter crescentus NC_011916 Rich medium - CCUGCACCA
ENCR40010171 promoter; regulatory region Regulatory_region_ID: RR_00283 TSS position: -; CCNA leading gene: CCNA_00283 ; CCNA lagging gene: CCNA_00283 ; annotation of leading gene: 2 Caulobacter crescentus NC_011916 Rich medium GCCUCGACCUCCGAACACGUCCAUUUCCGCACCAACGAUCUCGCCGAGUUCCUGAGCUCGGCGCGCCUGCAAGGAAGCCCCGC
ENCR40010172 promoter; regulatory region Regulatory_region_ID: RR_00295 TSS position: -; CCNA leading gene: CCNA_00295 ; CCNA lagging gene: CCNA_00295 ; annotation of leading gene: phosphate transport system protein phoU Caulobacter crescentus NC_011916 Rich medium - GAGAAAACAGAGA
ENCR40010173 promoter; regulatory region Regulatory_region_ID: RR_00304 TSS position: -; CCNA leading gene: CCNA_00304 ; CCNA lagging gene: CCNA_00303 ; annotation of leading gene: 3-deoxy-D-manno-octulosonic-acid transferase Caulobacter crescentus NC_011916 Rich medium - GACCUGCACAUCUGGGCGAUGAGCACCACCGAGACCGCCCUGACCGCCCACGUCGUCCGUCAGCUGGACGCCGACCAUGACCAGUUCCUGCACGACGCCUGCGCCGAACUGGCCAGCCGGUUCAACAUCGGCCACGUGACCAUCCAGGUGGAAAGCGGCCACGGCGCGCAUGC
ENCR40010174 promoter; regulatory region Regulatory_region_ID: RR_00306 TSS position: -; CCNA leading gene: CCNA_00306 ; CCNA lagging gene: CCNA_00306 ; annotation of leading gene: hypothetical protein Caulobacter crescentus NC_011916 Rich medium - GAUCUGGACCACCCGGCGCCCGACCAGGACGGGGAGAUCACGGC
ENCR40010175 promoter; regulatory region Regulatory_region_ID: RR_00307 TSS position: -; CCNA leading gene: CCNA_00307 ; CCNA lagging gene: CCNA_00307 ; annotation of leading gene: phospholipid-lipopolysaccharide ABC transporter Caulobacter crescentus NC_011916 Rich medium - GCCUCGCCCUGACAGCCGACCCCUCCCCC
ENCR40010176 promoter; regulatory region Regulatory_region_ID: RR_00308 TSS position: -; CCNA leading gene: CCNA_00308 ; CCNA lagging gene: CCNA_00308 ; annotation of leading gene: hypothetical protein Caulobacter crescentus NC_011916 Rich medium - CCCUAGUUAGGACCGGAAUUUCCGAAGGAUCGCGCCGCCU
ENCR40010177 promoter; regulatory region Regulatory_region_ID: RR_00309 TSS position: -; CCNA leading gene: CCNA_00309 ; CCNA lagging gene: CCNA_00309 ; annotation of leading gene: cytosolic protein Caulobacter crescentus NC_011916 Rich medium - CCAUUGAUCCUUAACCGUGUCGGGCAUAUCGAGCUGCCAUAACUAUAAUUCCUCGCAGGAAC
ENCR40010178 promoter; regulatory region Regulatory_region_ID: RR_00317 TSS position: -66a ; CCNA leading gene: CCNA_00317 ; CCNA lagging gene: CCNA_00317 ; annotation of leading gene: GTP-binding protein CgtA Caulobacter crescentus NC_011916 Rich medium - CCUUGGGACAAAAGGACCCC
ENCR40010179 promoter; regulatory region Regulatory_region_ID: RR_00320 TSS position: -; CCNA leading gene: CCNA_00320 ; CCNA lagging gene: CCNA_00320 ; annotation of leading gene: LSU ribosomal protein L27P Caulobacter crescentus NC_011916 Rich medium - CUUCUAAGGUAGGAGAGCAAG
ENCR40010180 promoter; regulatory region Regulatory_region_ID: RR_00321 TSS position: 72a ; CCNA leading gene: CCNA_00321 ; CCNA lagging gene: CCNA_00321 ; annotation of leading gene: LSU ribosomal protein L21P Caulobacter crescentus NC_011916 Rich medium - GCCCUCUUGUGUGCUUUCGUCGCGCGCCUCGGCUGAAUCCGCCGCUACGCCGUUGACUCCCGAGCCUUGGGCUGUAUAAGUCGCGCCCUCUUCGCCCGCCGGGUUUCCGAGCGGGCGUUCCCUAUUUUGCGAACGCACGUUUUUAAGGCGCUAACCU
Go to page: