Accession Number |
|
Cross-Ref |
Description |
|
RefSeq |
|
locus_tag |
Nucleotide_sequence |
ENCR40010181 |
promoter; regulatory region |
Regulatory_region_ID: RR_00340 |
TSS position: 38a ; CCNA leading gene: CCNA_00340 ; CCNA lagging gene: CCNA_00341 ; annotation of leading gene: succinyl-CoA synthetase subunit beta |
Caulobacter crescentus |
NC_011916 |
Rich medium |
- |
CCUUCACCUUAUCGCCCACACGCGGUUGCGCCUGCGAAACAGCGCUCCUAUAACCCGGCCACAUUUCAGAAAGCCGUCGUCGAGACCGGGCCCUCA |
ENCR40010182 |
promoter; regulatory region |
Regulatory_region_ID: RR_00342 |
TSS position: -; CCNA leading gene: CCNA_00342 ; CCNA lagging gene: CCNA_00343 ; annotation of leading gene: 2-oxoglutarate dehydrogenase E1 component |
Caulobacter crescentus |
NC_011916 |
Rich medium |
- |
UGCGGUAGCGCUCCCGUAAGCAGCGGAUCUGAAGGCGACAAAUCCA |
ENCR40010183 |
promoter; regulatory region |
Regulatory_region_ID: RR_00346 |
TSS position: 59a |
Caulobacter crescentus |
NC_011916 |
Rich medium |
|
CAAAGGUCUGACAGAACGGCCGGCGAGGCCCUACAUUUGUCCGGCGCCGCUUA |
ENCR40010184 |
promoter; regulatory region |
Regulatory_region_ID: RR_00354 |
TSS position: -; CCNA leading gene: CCNA_00354 ; CCNA lagging gene: CCNA_00354 ; annotation of leading gene: hypothetical protein |
Caulobacter crescentus |
NC_011916 |
Rich medium |
- |
GCCGGAGCGUGAUAAACACUCUUUUCACCAAUCGUCGGUAGGGUUAUCCCUUCACCCAGUGACGCGGGGGAGUGCCCACAGCA |
ENCR40010185 |
promoter; regulatory region |
Regulatory_region_ID: RR_00364 |
TSS position: 3a ; CCNA leading gene: CCNA_00364 ; CCNA lagging gene: CCNA_00364 ; annotation of leading gene: deoxyhypusine synthase |
Caulobacter crescentus |
NC_011916 |
Rich medium |
- |
CCCUCCGGUCGCUCCGUCCCGGUGAAGAGC |
ENCR40010186 |
promoter; regulatory region |
Regulatory_region_ID: RR_00365 |
TSS position: -; CCNA leading gene: CCNA_00365 ; CCNA lagging gene: CCNA_00365 ; annotation of leading gene: ornithine decarboxylase |
Caulobacter crescentus |
NC_011916 |
Rich medium |
- |
GCUCCGGCGGACCCGAAGUCCUCUAAACGCUGCUAACGCCGGCCUGGGUUUAACUUCCAACAGGGGGUUACGUGAA |
ENCR40010187 |
promoter; regulatory region |
Regulatory_region_ID: RR_00374 |
TSS position: -; CCNA leading gene: CCNA_00374 ; CCNA lagging gene: CCNA_00370 ; annotation of leading gene: putative ATP synthase protein I |
Caulobacter crescentus |
NC_011916 |
Rich medium |
- |
CCUUGACGCACCGCAGCGAGGUCUAUAGGUUCCGCGCCGAUCAAGCCGGCCGGAAAAGCGCCUCGUUUUGGCGCGUCCUCGGCGUUUUCGGACCUGCCGCUUCCC |
ENCR40010188 |
promoter; regulatory region |
Regulatory_region_ID: RR_00379 |
TSS position: 18a ; CCNA leading gene: CCNA_00379 ; CCNA lagging gene: CCNA_00378 ; annotation of leading gene: thiol:disulfide interchange protein dsbA |
Caulobacter crescentus |
NC_011916 |
Rich medium |
- |
CUUCCCAAUCGACCGCCAAGGGGCCCAUUC |
ENCR40010189 |
promoter; regulatory region |
Regulatory_region_ID: RR_00380 |
TSS position: -; CCNA leading gene: CCNA_00380 ; CCNA lagging gene: CCNA_00380 ; annotation of leading gene: cytosolic protein |
Caulobacter crescentus |
NC_011916 |
Rich medium |
- |
UACCAGGCCAGCAGGGCCGAGCGGAGAGCGUCGCGGUCUUUCAUGGCCCUUCGCCUACCGCGAACCGGCGGCCCCAUGCUAGUUUCCUCGC |
ENCR40010190 |
promoter; regulatory region |
Regulatory_region_ID: RR_00382 |
TSS position: 46b ; CCNA leading gene: CCNA_00382 ; CCNA lagging gene: CCNA_00382 ; annotation of leading gene: adenine-specific methyltransferase ccrM |
Caulobacter crescentus |
NC_011916 |
Rich medium |
- |
GGUUAACGGCCCGCUAACCACGUCUCUCAACACCGGAUUUACCAGGAAGACUCAUGAUUCCGCUCUCUUUCUUGAGGACGUGGGACC |
ENCR40010191 |
promoter; regulatory region |
Regulatory_region_ID: RR_00390 |
TSS position: -6a ; CCNA leading gene: CCNA_00390 ; CCNA lagging gene: CCNA_00390 ; annotation of leading gene: ADP-heptose--LPS heptosyltransferase |
Caulobacter crescentus |
NC_011916 |
Rich medium |
- |
CCUAUAGGUGUACCGA |
ENCR40010192 |
promoter; regulatory region |
Regulatory_region_ID: RR_00421 |
TSS position: -; CCNA leading gene: CCNA_00421 ; CCNA lagging gene: CCNA_00420 ; annotation of leading gene: dihydroneopterin aldolase |
Caulobacter crescentus |
NC_011916 |
Rich medium |
- |
CCCUAGAGCCUGCUUGGAACAACAGGCUCGACCAAGUUGAAAGAAAGGCCGCGCCUUGGCCGCUUCGCCCCUCGCCGACCCCGCGCCCGCCGCCGACACCGCCCGGAUCAUC |
ENCR40010193 |
promoter; regulatory region |
Regulatory_region_ID: RR_00465 |
TSS position: -; CCNA leading gene: CCNA_00465 ; CCNA lagging gene: CCNA_00465 ; annotation of leading gene: UDP-galactopyranose mutase |
Caulobacter crescentus |
NC_011916 |
Rich medium |
- |
CUAAACAUCGUGGA |
ENCR40010194 |
promoter; regulatory region |
Regulatory_region_ID: RR_00466 |
TSS position: -; CCNA leading gene: CCNA_00466 ; CCNA lagging gene: CCNA_00466 ; annotation of leading gene: glycosyltransferase |
Caulobacter crescentus |
NC_011916 |
Rich medium |
- |
GAUAGGCGAGUGUAGGUCGUUUUUGUCAUUCAGGAAGGGAAGCGUUCUUAAAUUUCCUGAAUAUUAAGUAUUAUAGCUACGAUUGGAGCGACGA |
ENCR40010195 |
promoter; regulatory region |
Regulatory_region_ID: RR_00467 |
TSS position: -; CCNA leading gene: CCNA_00467 ; CCNA lagging gene: CCNA_00467 ; annotation of leading gene: oligosaccharide translocase/flippase |
Caulobacter crescentus |
NC_011916 |
Rich medium |
- |
ACAACUGUCUACAGUUGUUGAAACGGCAAUAAUUUA |
ENCR40010196 |
promoter; regulatory region |
Regulatory_region_ID: RR_00469 |
TSS position: -; CCNA leading gene: CCNA_00469 ; CCNA lagging gene: CCNA_00469 ; annotation of leading gene: glycosyltransferase |
Caulobacter crescentus |
NC_011916 |
Rich medium |
- |
GAUAUACGGCCAUUAAGCUUCAUAGGGAUUACCGUAUUCCA |
ENCR40010197 |
promoter; regulatory region |
Regulatory_region_ID: RR_99991 |
TSS position: -; CCNA leading gene: CCNA_99991 ; CCNA lagging gene: CCNA_99991 ; annotation of leading gene: tRNA-Ser |
Caulobacter crescentus |
NC_011916 |
Rich medium |
- |
AGUCCGGCCCCCGCUUUCCUGCCGUGGAUCUCAGCAAGCUCUGACGGUCCGGCCGCAGACCGGCGGCGAAGUCCGCCCGCCAGGCGGCCGCCAAAUUCGGUUGCAGGCGGAUGAUUUCCCGCCUGCGGCGCUGACCGCAAAAAAGCUUGGAAAGAAAGCGCACCGGGGGCUUGCGUCUUCUGGGCGACGCCGCUAGGUAUCGCGCCCUCGACCUCGGGCGGCAAUUAUCGGCCUCCUGAACGGCGCCU |
ENCR40010198 |
promoter; regulatory region |
Regulatory_region_ID: RR_00492 |
TSS position: 39a |
Caulobacter crescentus |
NC_011916 |
Rich medium |
|
CCUUCCUCUACGUCAGAACCCAGAGUCA |
ENCR40010199 |
promoter; regulatory region |
Regulatory_region_ID: RR_00494 |
TSS position: -; CCNA leading gene: CCNA_00494 ; CCNA lagging gene: CCNA_00494 ; annotation of leading gene: transport protein |
Caulobacter crescentus |
NC_011916 |
Rich medium |
- |
ACCCCACCUAGGCGACGA |
ENCR40010200 |
promoter; regulatory region |
Regulatory_region_ID: RR_00496 |
TSS position: -; CCNA leading gene: CCNA_00496 ; CCNA lagging gene: CCNA_00496 ; annotation of leading gene: threonyl-tRNA synthetase |
Caulobacter crescentus |
NC_011916 |
Rich medium |
- |
GGCUGGGGUUGCGACGGAUCUGCCGCUGCAAUCCGUUUGGUGGAUCGGGCUACGACCCGCCGCCGCCGCGACACCAGCCACGCAAGUGGAAAUGUGAAGAA |
ENCR40010201 |
promoter; regulatory region |
Regulatory_region_ID: RR_00500 |
TSS position: -; CCNA leading gene: CCNA_00500 ; CCNA lagging gene: CCNA_00500 ; annotation of leading gene: hydroxymethylglutaryl-CoA lyase |
Caulobacter crescentus |
NC_011916 |
Rich medium |
- |
CCCCCCAGGAGGCCCAGCC |
ENCR40010202 |
promoter; regulatory region |
Regulatory_region_ID: RR_00502 |
TSS position: -; CCNA leading gene: CCNA_00502 ; CCNA lagging gene: CCNA_00502 ; annotation of leading gene: glycosyl transferase family protein |
Caulobacter crescentus |
NC_011916 |
Rich medium |
- |
CUUUAGCACGAUCCUUUCGUGGGGAAAUUUUUCCGGUAUUAGAGGGCGA |
ENCR40010203 |
promoter; regulatory region |
Regulatory_region_ID: RR_00501 |
TSS position: -; CCNA leading gene: CCNA_00501 ; CCNA lagging gene: CCNA_00501 ; annotation of leading gene: glucosyltransferase |
Caulobacter crescentus |
NC_011916 |
Rich medium |
- |
UGCUAAAGCAGGCGGU |
ENCR40010204 |
promoter; regulatory region |
Regulatory_region_ID: RR_00517 |
TSS position: -; CCNA leading gene: CCNA_00517 ; CCNA lagging gene: CCNA_00517 ; annotation of leading gene: peptidyl-tRNA hydrolase |
Caulobacter crescentus |
NC_011916 |
Rich medium |
- |
GCCUUCGGGUCCGCCCGUUUUUGUUUGAACACCCGAGAUCUUCGCG |
ENCR40010205 |
promoter; regulatory region |
Regulatory_region_ID: RR_00520 |
TSS position: 14a |
Caulobacter crescentus |
NC_011916 |
Rich medium |
|
CCCUGCCCCGAGCCAUCCC |
ENCR40010206 |
promoter; regulatory region |
Regulatory_region_ID: RR_00524 |
TSS position: -; CCNA leading gene: CCNA_00524 ; CCNA lagging gene: CCNA_00524 ; annotation of leading gene: conserved cytosolic protein |
Caulobacter crescentus |
NC_011916 |
Rich medium |
- |
ACGCCGAGGCGC |
ENCR40010207 |
promoter; regulatory region |
Regulatory_region_ID: RR_00525 |
TSS position: -; CCNA leading gene: CCNA_00525 ; CCNA lagging gene: CCNA_00525 ; annotation of leading gene: prolipoprotein diacylglyceryl transferase |
Caulobacter crescentus |
NC_011916 |
Rich medium |
- |
GAGCCCGAGCGC |
ENCR40010208 |
promoter; regulatory region |
Regulatory_region_ID: RR_00530 |
TSS position: -; CCNA leading gene: CCNA_00530 ; CCNA lagging gene: CCNA_00531 ; annotation of leading gene: LSU ribosomal protein L10P |
Caulobacter crescentus |
NC_011916 |
Rich medium |
- |
UUGAAAUCUCCCCCGUCUUCGUCUAUACGGCGCGCCUUCUCCGAUGGACUCCGGUCCGUUGGCGAACCUGUUUGAGAACAACGGGGCGUGGGGUCACCAACGCCGUAACCGAGGAAGAGCCCUUCCUCGCCGUCGGGAGACAGGGAUAGAGACGCCAAGUCUUCCUGCUCGUGACCCCCUUCCUCGUGUUGGGCCGGUCCGAGACCGGAACGCGGCCGACUUUCCUUGAAACAGGCACAUGCGACUCGCACGCGGGAGCGAUCCCGCUUGGGUUUCGCAUCUGGCUGCCGGAAUGGUCCGGCCGCUGUUAUUGAGUAGGAGACCGCAA |
ENCR40010209 |
promoter; regulatory region |
Regulatory_region_ID: RR_00536 |
TSS position: -; CCNA leading gene: CCNA_00536 ; CCNA lagging gene: CCNA_00537 ; annotation of leading gene: DNA-directed RNA polymerase subunit beta |
Caulobacter crescentus |
NC_011916 |
Rich medium |
- |
CCCUUUCCUUCCCCGUGCUGUUCCCCUAUAUCCCCGCGUUCACGAUGACAUCGGCGGAGCGCUUUUGCGCGUCCGUAUUACGCCCCGAGGCGCGGUCAGCCGCCCUCCGACCAGCGCGAAGGGGCGCCCGUCAGGCUUCCGGUCCCGGUCGCCCGACAGGGGAAUUCCAGCGUCCGCAGCUCUCCGACGAGGAGAGCGGCGAGGGUGGACGCAGCGGAUAUUCGAAUUCACGCGCGGACUCCGUCCGCGCCGCAGGGAAACAACA |
ENCR40010210 |
promoter; regulatory region |
Regulatory_region_ID: RR_00546 |
TSS position: -; CCNA leading gene: CCNA_00546 ; CCNA lagging gene: CCNA_00546 ; annotation of leading gene: hypothetical protein |
Caulobacter crescentus |
NC_011916 |
Rich medium |
- |
CCAAGAUUCGCCCCAGUCGACGGGCAGUACGGAUCGCA |